J. Gen. Appl. Microbiol., 48, 293–297 (2002)
نویسندگان
چکیده
phic yeasts characterized by the production of arthroconidia. Twenty-six species have been listed in the genus Trichosporon, which includes medically relevant species that cause opportunistic infections and induce summer-type hypersensitivity pneumonitis (SHP) (Ando et al., 1995; Guého et al., 1994, 1998; Middelhoven et al., 1999, 2000a, b; Sugita et al., 2001). Besides pathogens, Trichosporon species are widely distributed in the environment, and are also used as a biological sensor in industry to determine biochemical oxygen demand (Yang et al., 1996). While analyzing the diversity of Trichosporon in the soil, we found a new Trichosporon species. In this paper, we propose a new species, Trichosporon terricola sp. nov., for the isolates. Strains M9900, M9952, and M9953 used in this study were isolated in July 1997 from soil in Niiza, Saitama, Japan. Most of their morphological, biochemical, and physiological characteristics were examined using the methods described by Yarrow (1998). Their biochemical characteristics were also investigated using ID32C (bioMérieux SA, Marcy I’Etoile, France) in accordance with the manufacturer’s instructions. Ubiquinone molecules were identified according to the method of Nakase and Suzuki (1986). The DNA base composition (mol% G C) was determined by nucleotide analysis, using HPLC after digesting the DNA with Nuclease P1 (Yamasa Shouyu, Chiba) as described by Tamaoka and Komagata (1984). Xylose was detected in cell wall polysaccharides by gas chromatography as previously described by Sugita et al. (2001). The internal transcribed spacer (ITS) regions (Sugita et al., 1999), D1/D2 regions of 26S rDNA (Kurtzman and Robnett, 1997), and intergenic spacer (IGS) 1 region (Sugita et al., 2002) were determined directly using PCR products with primers: pITS-F (5 GTCGTAACAAGGTTAACCTGCGG) and pITS-R (5 TCCTCCGCTTATTGATATGC), NL-1 (5 -GCATATCAATAAGCGGAGGAAAAG) and NL-4 (5 -GGTCCGTGTTTCAAGACGG), and 26SF (5 -ATCCTTTGCAGACGACTTGA) and 5SR (5 -AGCTTGACTTCGCAGATCGG), respectively, using an ABI 310 DNA sequencer A basidiomycetous anamorphic yeast, Trichosporon terricola sp. nov., isolated from soil
منابع مشابه
J. Gen. Appl. Microbiol., 48, 35–41 (2002)
A river-ecosystem is strongly affected by human activities. The pollutants discharged into a river from human activities may destroy the ecosystem of the river. Microorganisms in rivers (including suspended and sessile microorganisms) play key roles in degrading the pollutant and therefore in preventing the river ecosystem from being destroyed. To establish suitable measures for the protection ...
متن کاملJ. Gen. Appl. Microbiol., 48, 261–267 (2002)
The selection of wine yeasts for enological use was traditionally carried out on the basis of their technological and quality-linked phenotypical characteristics (Giudici and Zambonelli, 1992). For this purpose different methodologies were designed. Recently a two-step procedure was proposed: a pre-selection based on resistance to SO2, killer activity, growth at high temperature and low foam pr...
متن کاملDark-light transitions with a heterotrophic culture of a blue-green alga.
Cashel, M. (1969) J. Biol. Chem. 244, 3133-3141 Cooper, S. & Helmstetter, C. E. (1968) J. Mol. Biol. 31, 519-540 Donachie, W. D. (1968) Nature (London) 219, 1077-1079 Doolittle, W. F. (1972) J. Bacteriol. 111, 316-324 Doolittle, W. F. (1973) J. Bacteriol. 113, 1256-1263 Grierson, D. & Smith, H. (1973) Eur. J . Biochem. 36, 280-285 Herdman, M., Faulkner, B. M. & Carr, N. G. (1970) Arch. Mikrobio...
متن کاملJ. Gen. Appl. Microbiol., 57, 331‒339 (2011)
Bacteria are fundamentally divided into two groups, Gram-positive and -negative, based on the chemical and physical properties of their cell walls. The classic Gram stain reaction permits the useful distinction between Gram-positive and -negative bacteria. Gram staining results largely affect the initial classifi cation of an unknown bacterium and the selection of follow-up identifi cation proc...
متن کاملJ. Gen. Appl. Microbiol., 48, 269–279 (2002)
Isolation and taxonomic and phylogenetic studies performed in this decade have revealed that most Gram-positive, aerobic spore-forming bacteria which have halophilic/halotolerant/alkaliphilic and/or alkalitolerant properties compose a considerably large phylogenetic group within rRNA 1 group of Ash et al. (1991) in the phyletic assemblage of bacteria classically defined as the genus Bacillus (A...
متن کامل